Merge staging-next into staging

This commit is contained in:
github-actions[bot] 2023-10-21 06:01:24 +00:00 committed by GitHub
commit e5968ce788
No known key found for this signature in database
GPG Key ID: 4AEE18F83AFDEB23
12 changed files with 115 additions and 31 deletions

View File

@ -565,7 +565,7 @@ Names of files and directories should be in lowercase, with dashes between words
- Do not use tab characters, i.e. configure your editor to use soft tabs. For instance, use `(setq-default indent-tabs-mode nil)` in Emacs. Everybody has different tab settings so its asking for trouble. - Do not use tab characters, i.e. configure your editor to use soft tabs. For instance, use `(setq-default indent-tabs-mode nil)` in Emacs. Everybody has different tab settings so its asking for trouble.
- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [](#sec-package-naming). - Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [package naming](./pkgs/README.md#package-naming).
- Function calls with attribute set arguments are written as - Function calls with attribute set arguments are written as

View File

@ -19363,6 +19363,11 @@
github = "ymeister"; github = "ymeister";
githubId = 47071325; githubId = 47071325;
}; };
ymstnt = {
name = "YMSTNT";
github = "ymstnt";
githubId = 21342713;
};
yoavlavi = { yoavlavi = {
email = "yoav@yoavlavi.com"; email = "yoav@yoavlavi.com";
github = "yoav-lavi"; github = "yoav-lavi";

View File

@ -103,9 +103,9 @@ in
}; };
bantime = mkOption { bantime = mkOption {
default = null; default = "10m";
type = types.nullOr types.str; type = types.str;
example = "10m"; example = "1h";
description = lib.mdDoc "Number of seconds that a host is banned."; description = lib.mdDoc "Number of seconds that a host is banned.";
}; };

View File

@ -1,26 +1,62 @@
{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }: { lib
, stdenv
, fetchFromGitHub
, cmake
, perl
, python3
, tbb
, zlib
, runCommand
, bowtie2
}:
stdenv.mkDerivation rec { stdenv.mkDerivation (finalAttrs: {
pname = "bowtie2"; pname = "bowtie2";
version = "2.5.2"; version = "2.5.2";
src = fetchFromGitHub { src = fetchFromGitHub {
owner = "BenLangmead"; owner = "BenLangmead";
repo = pname; repo = "bowtie2";
rev = "v${version}"; rev = "refs/tags/v${finalAttrs.version}";
sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0="; fetchSubmodules = true;
hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0=";
}; };
# because of this flag, gcc on aarch64 cannot find the Threads
# Could NOT find Threads (missing: Threads_FOUND)
# TODO: check with other distros and report upstream
postPatch = ''
substituteInPlace CMakeLists.txt \
--replace "-m64" ""
'';
nativeBuildInputs = [ cmake ]; nativeBuildInputs = [ cmake ];
buildInputs = [ tbb zlib python3 perl ]; buildInputs = [ tbb zlib python3 perl ];
cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];
# ctest fails because of missing dependencies between tests
doCheck = false;
passthru.tests = {
ctest = runCommand "${finalAttrs.pname}-test" { } ''
mkdir $out
${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
${bowtie2}/bin/bowtie2-inspect-s $out/small
${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
${bowtie2}/bin/bowtie2-inspect-l $out/large
'';
};
meta = with lib; { meta = with lib; {
description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences"; description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
license = licenses.gpl3; license = licenses.gpl3Plus;
homepage = "http://bowtie-bio.sf.net/bowtie2"; homepage = "http://bowtie-bio.sf.net/bowtie2";
changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}";
maintainers = with maintainers; [ rybern ]; maintainers = with maintainers; [ rybern ];
platforms = platforms.all; platforms = platforms.all;
broken = stdenv.isAarch64; # only x86 is supported mainProgram = "bowtie2";
}; };
} })

View File

@ -0,0 +1,41 @@
{ lib, appimageTools, fetchurl }:
let
version = "0.9.9.5";
pname = "hifile";
src = fetchurl {
url = "https://www.hifile.app/files/HiFile-${version}.AppImage";
hash = "sha256-Ks/NLPm5loo9q8pT0LdtfcrC38203beNE74sbEpyuJM=";
};
appimageContents = appimageTools.extractType2 {
inherit pname version src;
};
in
appimageTools.wrapType2 rec {
inherit pname version src;
extraInstallCommands = ''
mv $out/bin/${pname}-${version} $out/bin/${pname}
install -m 444 -D ${appimageContents}/HiFile.desktop $out/share/applications/HiFile.desktop
install -m 444 -D ${appimageContents}/HiFile.png $out/share/icons/hicolor/512x512/apps/HiFile.png
substituteInPlace $out/share/applications/HiFile.desktop \
--replace 'Exec=HiFile' 'Exec=${pname}'
'';
meta = with lib; {
description = "Dual-pane graphical file manager for Windows, macOS and Linux";
longDescription = ''
HiFile is the next evolution of file managers. Its mission is to increase your productivity whenever you work with files or folders. It aims to be better in every way - more convenient, more versatile, more efficient, more elegant, more customizable, and more fun.
'';
homepage = "https://www.hifile.app/";
downloadPage = "https://www.hifile.app/download";
license = licenses.unfree;
sourceProvenance = with sourceTypes; [ binaryNativeCode ];
maintainers = with maintainers; [ ymstnt ];
platforms = [ "x86_64-linux" ];
};
}

View File

@ -17,13 +17,13 @@
assert lib.elem lineEditingLibrary [ "isocline" "readline" ]; assert lib.elem lineEditingLibrary [ "isocline" "readline" ];
stdenv.mkDerivation (finalAttrs: { stdenv.mkDerivation (finalAttrs: {
pname = "trealla"; pname = "trealla";
version = "2.28.12"; version = "2.29.36";
src = fetchFromGitHub { src = fetchFromGitHub {
owner = "trealla-prolog"; owner = "trealla-prolog";
repo = "trealla"; repo = "trealla";
rev = "v${finalAttrs.version}"; rev = "v${finalAttrs.version}";
hash = "sha256-uWCpCjYFtK2pNeHHZWhWI6YZ+cllQpkKz//nHracl5s="; hash = "sha256-tQp2DOBW71Wm1aQqspW9tuH8aM8ir+ilZiENdElB/+0=";
}; };
postPatch = '' postPatch = ''

View File

@ -2,11 +2,11 @@
stdenvNoCC.mkDerivation rec { stdenvNoCC.mkDerivation rec {
pname = "flix"; pname = "flix";
version = "0.40.0"; version = "0.41.0";
src = fetchurl { src = fetchurl {
url = "https://github.com/flix/flix/releases/download/v${version}/flix.jar"; url = "https://github.com/flix/flix/releases/download/v${version}/flix.jar";
sha256 = "sha256-NVQY2TgIR9ROy4x8PWxCjuaOkNx0bcUA4oZHjpQbHc4="; sha256 = "sha256-bDeqwk+grkCxmGE9H8Ks7Q8KvLxNCzaLe44DlR6E7YE=";
}; };
dontUnpack = true; dontUnpack = true;

View File

@ -9,14 +9,14 @@
buildPythonPackage rec { buildPythonPackage rec {
pname = "wallbox"; pname = "wallbox";
version = "0.4.14"; version = "0.5.1";
format = "setuptools"; format = "setuptools";
disabled = pythonOlder "3.7"; disabled = pythonOlder "3.7";
src = fetchPypi { src = fetchPypi {
inherit pname version; inherit pname version;
hash = "sha256-HKlq5DPG3HD9i9LLTJdlzEFim+2hBdSfKl43BojhEf8="; hash = "sha256-EDEB7/CkrfYSNcSh55Itrj6rThsNKeuj8lHLAY+Qml4=";
}; };
propagatedBuildInputs = [ propagatedBuildInputs = [

View File

@ -15,16 +15,16 @@ let
in in
rustPlatform.buildRustPackage rec { rustPlatform.buildRustPackage rec {
pname = "texlab"; pname = "texlab";
version = "5.10.0"; version = "5.10.1";
src = fetchFromGitHub { src = fetchFromGitHub {
owner = "latex-lsp"; owner = "latex-lsp";
repo = "texlab"; repo = "texlab";
rev = "refs/tags/v${version}"; rev = "refs/tags/v${version}";
hash = "sha256-MTWaGgDIDo3CaRHyHWqliKsPdbU/TZPsyfF7SoHTnhk="; hash = "sha256-ACdiFkV138jDIrRe+baYo+r9vCO4cyRyO2ck7OKakFY=";
}; };
cargoHash = "sha256-8Vrp4d5luf91pKpUC4wWn4otsanqopCHwCjcnfTzyLk="; cargoHash = "sha256-bEeQOOucXd4HNTR6SmidAfDkZ1tT7ORmUxrNx+3FNRw=";
outputs = [ "out" ] ++ lib.optional (!isCross) "man"; outputs = [ "out" ] ++ lib.optional (!isCross) "man";
@ -41,7 +41,7 @@ rustPlatform.buildRustPackage rec {
# generate the man page # generate the man page
postInstall = lib.optionalString (!isCross) '' postInstall = lib.optionalString (!isCross) ''
# TexLab builds man page separately in CI: # TexLab builds man page separately in CI:
# https://github.com/latex-lsp/texlab/blob/v5.9.2/.github/workflows/publish.yml#L117-L121 # https://github.com/latex-lsp/texlab/blob/v5.10.1/.github/workflows/publish.yml#L117-L121
help2man --no-info "$out/bin/texlab" > texlab.1 help2man --no-info "$out/bin/texlab" > texlab.1
installManPage texlab.1 installManPage texlab.1
''; '';

View File

@ -68,7 +68,7 @@
mipsel-linux = import ./bootstrap-files/mipsel-unknown-linux-gnu.nix; mipsel-linux = import ./bootstrap-files/mipsel-unknown-linux-gnu.nix;
mips64el-linux = import mips64el-linux = import
(if localSystem.isMips64n32 (if localSystem.isMips64n32
then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix.nix then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix
else ./bootstrap-files/mips64el-unknown-linux-gnuabi64.nix); else ./bootstrap-files/mips64el-unknown-linux-gnuabi64.nix);
powerpc64le-linux = import ./bootstrap-files/powerpc64le-unknown-linux-gnu.nix; powerpc64le-linux = import ./bootstrap-files/powerpc64le-unknown-linux-gnu.nix;
riscv64-linux = import ./bootstrap-files/riscv64-unknown-linux-gnu.nix; riscv64-linux = import ./bootstrap-files/riscv64-unknown-linux-gnu.nix;

View File

@ -2,13 +2,13 @@
buildGoModule rec { buildGoModule rec {
pname = "syft"; pname = "syft";
version = "0.92.0"; version = "0.93.0";
src = fetchFromGitHub { src = fetchFromGitHub {
owner = "anchore"; owner = "anchore";
repo = pname; repo = pname;
rev = "v${version}"; rev = "v${version}";
hash = "sha256-YmzizpcAfE4+Rfq5ydQnDQBo4R+pAyudfi+fqD9EZP0="; hash = "sha256-e8d+CK7rRbyHeRHOjK3tGFIBHuosdV4AMetUQar54E4=";
# populate values that require us to use git. By doing this in postFetch we # populate values that require us to use git. By doing this in postFetch we
# can delete .git afterwards and maintain better reproducibility of the src. # can delete .git afterwards and maintain better reproducibility of the src.
leaveDotGit = true; leaveDotGit = true;
@ -22,7 +22,7 @@ buildGoModule rec {
}; };
# hash mismatch with darwin # hash mismatch with darwin
proxyVendor = true; proxyVendor = true;
vendorHash = "sha256-siOZWhHqNokkYAPwuXQCs4T1yBiEWUTJzhfbH/Z2uBk="; vendorHash = "sha256-BUCe2v80tHAqMBwa6xae3ZOTOok8msM6hFh6d9D4xZA=";
nativeBuildInputs = [ installShellFiles ]; nativeBuildInputs = [ installShellFiles ];

View File

@ -1,17 +1,17 @@
{ lib, mkDerivation, fetchFromGitHub, substituteAll, udev, stdenv { lib, wrapQtAppsHook, fetchFromGitHub, substituteAll, udev, stdenv
, pkg-config, qtbase, cmake, zlib, kmod, libXdmcp, qttools, qtx11extras, libdbusmenu , pkg-config, qtbase, cmake, zlib, kmod, libXdmcp, qttools, qtx11extras, libdbusmenu
, withPulseaudio ? stdenv.isLinux, libpulseaudio , withPulseaudio ? stdenv.isLinux, libpulseaudio, quazip
}: }:
mkDerivation rec { stdenv.mkDerivation rec {
version = "0.5.0"; version = "0.6.0";
pname = "ckb-next"; pname = "ckb-next";
src = fetchFromGitHub { src = fetchFromGitHub {
owner = "ckb-next"; owner = "ckb-next";
repo = "ckb-next"; repo = "ckb-next";
rev = "v${version}"; rev = "v${version}";
sha256 = "sha256-yR1myagAqavAR/7lPdufcrJpPmXW7r4N4pxTMF6NbuE="; hash = "sha256-G0cvET3wMIi4FlBmaTkdTyYtcdVGzK4X0C2HYZr43eg=";
}; };
buildInputs = [ buildInputs = [
@ -22,9 +22,11 @@ mkDerivation rec {
qttools qttools
qtx11extras qtx11extras
libdbusmenu libdbusmenu
quazip
] ++ lib.optional withPulseaudio libpulseaudio; ] ++ lib.optional withPulseaudio libpulseaudio;
nativeBuildInputs = [ nativeBuildInputs = [
wrapQtAppsHook
pkg-config pkg-config
cmake cmake
]; ];